EST 1824591 is a singleton


Sequence

>1824591 (1 EST) Length=214 GGGATTTGCCACTTTAGCCGCCAGAACCACAGGTGATTGGGACTTCGGTGCCGTCGTTCCGTCACTTCCCGTATAGGGCG CAGGATGTTCTGCATCTCTACCGTGATTTCTTGCGGCTCATCCANCAACACCCGCCGCAGAGCGAGCCGATCTTCTTTTT CGCCTGCACAACGAGTTTTACCGTCGGCGGCACCTCACGAGCCCCAAAATGATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1824591: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18245913392829AI069854TENU2831T. cruzi epimastigote normalized cDNA Library


Date: 21:31:6 on Fri 24 Nov 117.