EST 1824594 is a singleton


Sequence

>1824594 (1 EST) Length=406 CGCGGTGTTGGCGGTCTCATGTGCGTGGAAGGCGAGGGGACGCCTGTCGTCATGCAAGGATGGCCGTCGCTGTGGCGGCG TAAAAAAGTGCAGCGGTGGATACACGAAATCGATGCCACCAGTAAACGACGGTGCCCGCTTGGGCGTAAATTTAAATGTA GTCCAGCAGATTTGCAGCGGGGTGAGGCTGTAATTAAGGAGGAAGGCATTCTTCAGAGGAACCTGATGGATGAACTGTCA ATGAAGGCAGAGCAGGGCCTTTTCGTGACGCTGCTCGCCACACCTGATATTGTGAGGGGTGCCAGTGATGGGCTGCCACT TTTAGAGGGATGCTCGGCGTTGTGGTGTGAGAGAGCCGTTGGGGGAAAATTCATTCACCGCCACTGCCCCGACAACAACA ACAACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1824594: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18245943392832AI069857TENU2834T. cruzi epimastigote normalized cDNA Library


Date: 0:41:7 on Sat 25 Nov 117.