EST 1824599 is a singleton


Sequence

>1824599 (1 EST) Length=246 TGTGAAATTCGAGGGCACTGAAAGGACCAACAGCACACACACCGCCCACACACACATATTTACATGCTGTCACGTGTTGC TGCAGTCAAGGCACCCAACAAACACAGCCGTCGCCGCGTGAGCATCCAGCGGAACGGGGAGGGAAGGAAGAGAGAGTGAG CCGCAGAGGCCCAACATGTCCTGGCATGTGTTTGCTTCCGCCGTGCTGCTGCTCCTCGTCGTGATGATGTGCTGCGGTAC CTGTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1824599: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18245993392837AI069862TENU2839T. cruzi epimastigote normalized cDNA Library


Date: 7:24:40 on Mon 20 Nov 117.