EST 1824610 is a singleton


Sequence

>1824610 (1 EST) Length=341 ATCGTGCTGCTAACGCACAAAAAATGATAGAACGTTTTGTTGTTTGTCCGCCCGGCCCGCCACCATCACCTCTTCTAATA AGCTGCTGGAGCAAGATGTGCTTTGTTGAGGATGGGGATGCAGTGATTTACTATCTGCACATTAGGCATTGTACGGTAAA CGGTGCCTCGGCAAGTTCGGATACTCGCTTGACGATTCTTTACAGTCATGGGAATGCTGAAGATTTGGGGAGTTGCTATG AAGGACTTGTAGCGTTGTCGCGTGCGATTGGGGCCGATATCGTTGTGTATGACTATTGTGGCTATGGCTTTTCAAAAGCG AGGGGTCAAAGTGGACCAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1824610: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18246103392848AI069873TENU2921T. cruzi epimastigote normalized cDNA Library


Date: 12:2:39 on Thu 23 Nov 117.