EST 1824612 is a singleton


Sequence

>1824612 (1 EST) Length=407 GTCAGAGAGTGTGTCCCTGTGGAAGTCAGATCTGTTCTCAGCAGTCTTAAGGTGAATTTTGGATGTGAATTTCTTTTTCA TATTTGTTTTCCGGTAGATTTGGCAGCTCGCATCGGGAGGCGGTCACCACTGCCGCCGAGGCCATCGCTTCTCATATGGC CACTGCATTTAATTTGGGCGGTGGTCTCTCAGCGGCTGTGGAGGCAGATTGCGACAATAAAAATATTGGAGACAACACAA ATCATCATTTGTTTTGCGATAAACGTTGTACACGTTCTTCCCTTCTCGGCAGGAGCACTTCCCGTTCCGAGTCTTGGGAT TTTAAGGCGTGTCGAAAACCCCTTTTGTCGTCGGGGGAACGGTCGCAATTTACGCAATTTATTCATTCCCGCCACTGTTT GCCTGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1824612: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18246123392850AI069875TENU2923T. cruzi epimastigote normalized cDNA Library


Date: 0:37:33 on Thu 23 Nov 117.