EST 1824619 is a singleton


Sequence

>1824619 (1 EST) Length=479 GGTGGCGGCTCCATGCGTGGGGGGCGTTTCTCGGGTGCTGCTGTGCGGCATTGTGGCCCTTTACTGAGAAATTGCGGTGA GGACTTCCTGCCACCAGCTGGGACATATGCGTCTGGCCACGCGCTCTTTTAAAGTAATTGCCACTTTTTGTGGACACTTT GTTTTTTCTAGGAGCTTGTGAAAAGAATGATCACGGGAGAGCTGGCTAACTTAATTAATGTATGTGTACATCCTGGTAAA TGAATGCATTCTTTATGATACTTTCTACCGTATGAATCTTTTGGGAAGAACGCGACTTTGTAGGGGCAGGGAGCCGATAG AGGCCGGATAATATTTGCTTTTATTTTGCCATCCCACCCACCCCCTTGATTCCCACCACGCGGCGGGGTCTTGTGGTTGG AGGACCCCAAAGTCTGCCAATTCGTAAGTAATAATATTCAAATCCCAACTGAGGACAAAGGACCATGCTGGTGGTCAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1824619: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18246193392857AI069882TENU2930T. cruzi epimastigote normalized cDNA Library


Date: 23:13:20 on Mon 20 Nov 117.