EST 1824620 is a singleton


Sequence

>1824620 (1 EST) Length=519 ACCGCTCTTGACGGGTATCCGTCTTCATTATGCTCTTGCACGCAGCCGGTACCTGATCGCCACAACAGACACCAACGACC CTGCAGCAGACGGGTATCCCGAAGGTGCTGCGGAAGTGTGCGTGACAAGCTGAAATGATGCGTTTGCCATTTATGCGTGA TGCTATCATTCGCGAATGCGTGGTGCGGTCTTTTCAGGAGCACTATGTTTACACAGGCTGGCGATTTGCAGACGCCAACG ACGAGGAAATTCTTCAGAGTTTTCTACGGCGATACGAAGCGGAACTGTTTGCATGTGGTGTGGAGGAATTGTCTCACTTC AACATGTTGTCGCTGATGTTTGATGCGGCAGAGGGCGGCACGGGTAAAAGATGCATATGTGATTTTGTGCGTGTGATGTA TAGCTGTTGAGACTGCTTTTGCCAGGGCTGTCATTTAGGGGCCTCGTTGAACTATTGGGCGGGACTGGGGGGCACCATCT GGCATGCCTTTCACCCCCCACTCACGAGAAAAAGAGGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1824620: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18246203392858AI069883TENU2931T. cruzi epimastigote normalized cDNA Library


Date: 15:12:38 on Fri 24 Nov 117.