EST 1824623 is a singleton


Sequence

>1824623 (1 EST) Length=418 TGGTGTGACGCCGGGCACGTTGGTTACTTGCTGAATGACCCCTCCACCTTGGGCGAGCTCTTCTTTGCCCCACTCAAGCT GCACACCACAATCATGCTCTACTGCCTCGCCGAAAAGGAGACAGAGACTGGGGAGAAGGTGCTGTTATCCGAGTTGGCCT TCAACGATGCCTGCGTTGAGCGATCCAGTGGCCAAACCGCCCTCATCCGCATCCTCGTGAATGGCGAGGAGCGCATCCAT TTGTTGCGTGGCGACGGTGTGTTGGTATCGACGGCGGCTGGCAGCACGGCGTATTGTCAGGCACTCGGCGCATCGCCGTC CCGGTCGGGGCGCCGTTGATTCAAATCGTGGGCAGCAATGTCGTGTCCCCGGCGCAGTGGCGGCCGACGCATCTGAACCA GGAGGACCATGTGGAGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1824623: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18246233392861AI069886TENU2934T. cruzi epimastigote normalized cDNA Library


Date: 0:23:49 on Thu 23 Nov 117.