EST 1828060 is a singleton


Sequence

>1828060 (1 EST) Length=433 AAGGGGAAGTTGTCTCTGACGTTTTCCCTTCGACGCTGCGGGGACACAAAAGAAGCGAAGGTGTCGTTATTTCCAACTTT TATTGCTGTTGAAGTATTTGGTTTCATGACTTCTTTTGTAACGGATAACCTTGTGTGAAGCTCGGCGACGTTCATCCCGT AAGACGACACTTTTGTTGTTGCAGAGTATAAGTCATGAGGGCAATGTGGCAAAGTACAGTGTCTTTAACGCGGATCTGCA CCTCGATTCCCTCCAGTCATTCTCGTTGTTGCCTTTGCCATGTGAATTAACGTGGTCATTTAGGGTATATGCTGCCTGTT ACAGTTCCATGGAAACACAAATTCGCCTTGAAGAACCCTTCATGCACCTCCGCGAATGGAAGTCTAGGACGACGCAAGAG GAACGTTTTGCCATTGTAAAACCAAGCATGGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1828060: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18280603399517AI073323TENU2994T. cruzi epimastigote normalized cDNA Library


Date: 14:14:28 on Fri 19 Jan 118.