EST 1828063 is a singleton


Sequence

>1828063 (1 EST) Length=339 GGGAACCTCTAAACGAAACCGCTTTTGTCACGAAGCTACGCGGATTGTGTGATGACAAATACAAGTAATTGTGGCCATCA TTACGGCCCTCCCCTGCGTGTTCGCGGCACGCTGTCATTTTCAGTGTCACGGAGTGGACCAACAGCGATGCGGCGTGTGC GTGACAACAGGATGAGAACTATTATACGCCACTTGTCATGTTTTCCTCATCTTCTACTGATGCTGCATCCACAATTGCGC GGTATAACACGTCTTTTGGATTTTCGCTGCCGCCAAGCCTGCAGGTTGTCACACTGCAATTAATTGATCAGCAGAATTTG CTCTTGCGTCTTGGACACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1828063: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18280633399520AI073326TENU2997T. cruzi epimastigote normalized cDNA Library


Date: 7:1:52 on Tue 21 Nov 117.