EST 1828068 is a singleton


Sequence

>1828068 (1 EST) Length=274 CGTGACCGTTTAAGTCTAGCGCCCCCGGCATGATCCTCTTTGTGTTTCTCCGTCAGTGCATGTGCACGAAAAGTTTTTTT GTTTTAGGTGTGTGTTTGTTGTAACGGTGTGCCTGCACCTTTTTTTTCATACTGTCTTTGCTTCTACCGCTGCGGCGACA GCAACGCGGGGTTGACGGTGACGCAGGCGATAACAGACGAGTGTCGATGGGGGTTCCGTGGCGCCGGGTATCACATGCAT TTAGCCGTGGAGTTTCCGCTACACTATGACGAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1828068: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18280683399525AI073331TENU3002T. cruzi epimastigote normalized cDNA Library


Date: 23:13:38 on Mon 20 Nov 117.