EST 1830206 is a singleton


Sequence

>1830206 (1 EST) Length=365 GCGGCGGAGAAGTGGAAAGAATTGGACAACGCCTTGGGAGTTCCCACTGAAGGGCTGGTTGCCTTTTTGTGCCGGACGTT GGACGGGACTGCATGGAGGGACGAGTACCTCGGCGTGAATGCCGCAGTGAGGAGCGGAGTGACCAGCACGGAGAGCGGCG TGGCGCTCAAGGGAGCAGGGGCGCAGTGGCCTGTTGGCAGCATGGGGCAGACTGTGCCGTACTGCTTTACAAACAACGAG TTCACTCTTTCGGCGACGATGGCCATCCACGAGGTGCCGGACGAGCAGCAGCCCCATTAGTTTGATTGGTGCGAGGCTGA ACGACAAAGACGGCACGGCGCTCTTTCAGCTCTCGTGGACGAGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1830206: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18302063404482AI075531TENU3108T. cruzi epimastigote normalized cDNA Library


Date: 22:2:42 on Fri 17 Nov 117.