EST 1830207 is a singleton


Sequence

>1830207 (1 EST) Length=340 GCCGCACACGCGCACGCATCGAGTTTGACGTGGCAAACCACACCGATACCTGTGGTGCTGCGCCACGGTCTGATGGCACT TGAGAAAAAGCCGCTTTCCCCTGAAGCCTTTTTCAATGCGTTGCCTTCTACTTCTCGGAAGCAGCTGAAATGTGCTTATG CCTCCGTGGCGGACTTTGCGGCGCACCACTCGCTTTATTTATTTTTGAAGGACGGTCTCATTTGGACACCGTACCTCGCA GCCGTGTCACAGGGGGCGCGCGTTCCCGCATCCTCACGCAATGGTCCTCGGGTCGTCAATTAACCGATGCTGCAAAGGCC AAAATGATGATGGAGTTGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1830207: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18302073404483AI075532TENU3109T. cruzi epimastigote normalized cDNA Library


Date: 0:12:44 on Thu 23 Nov 117.