EST 1830228 is a singleton


Sequence

>1830228 (1 EST) Length=334 GGTGGGTGGTTATTTTATATTATTTTTTTAAAATTATTCTCCGCGGCTGTAAGCGGGATGAGGCCGTTGCTTATTTTTGG CCTGCGTGGCACCCTCGTGGAGCGCATCCACGCCAGTCGTGTGCCGCTCGGCATGCCTGATGGCGCCATCACTGTCGGTA TGAGTCGTGTGTGGCTGCGGCCAGGGGCGCTTGAGACGGCTGCAGGGCTGCAGGAGCACTGACACTTGCCGTCTGGAGCT CAACGACCGCCGAAACACGGCGCCGGTGATGGAGGCGGTCTTCCATGTGCAGAGCGCAGGCCGAAGGTGCGGTTTGCGTT TGTGTGGTCTCGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1830228: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18302283404504AI075553TENU3130T. cruzi epimastigote normalized cDNA Library


Date: 4:42:50 on Sat 25 Nov 117.