EST 1830230 is a singleton


Sequence

>1830230 (1 EST) Length=362 TTGATTTTGGTTCTGTGTATGATAAATAAAACGACGGAGTGAATTTTATTGCTGTTGGCTGCTTTACGAGGCAAGCGAGA AAACGGGGGTGTTCACGCGCACATAAATTTAACACTAGCAAAAAACGAGTGGTGGTGTAAAAAAGAAAAAAAGGTTGTAA ACAAAACGACGGGTGAAAAGACGGAGATTCAGTGCGGGGATGAGGTGATGGCTTTGGAGGGCCAAAGAAAGTAAAAAAAT CAAACGAAAAAATAATTCGGTGCGTACACGCGCATATTTAAGCGTGCTTCAAACGTAGACATGAATAATTTGGAAAAAAA AAAAAAACGAGATGTGCGCGATGTTGTGTGTGGGAGTTGTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1830230: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18302303404506AI075555TENU3132T. cruzi epimastigote normalized cDNA Library


Date: 20:51:15 on Wed 22 Nov 117.