EST 1830234 is a singleton


Sequence

>1830234 (1 EST) Length=227 ATATTTTCCATTTTTTGGGCCGCAAATGTTGTTTTAGGCCTCTCACATGTCACGACGGCGGGAGTTGTGGCGAAGTGGTA CTTTGCCGGCAGTGAGAACATGCCAGCTCGTCCAACTTGGGCATCATTTCAACGAGCCATAACAACAAGTTTTGGCTCCG TCTGTTTCGGGTCTTTGTTGTGCACATTGGTTGGTGCTTTTGGCTGGGTCTGTGGGCCTCGGTAATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1830234: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18302343404510AI075559TENU3136T. cruzi epimastigote normalized cDNA Library


Date: 5:6:17 on Tue 21 Nov 117.