EST 1830238 is a singleton


Sequence

>1830238 (1 EST) Length=340 GGAACTCACAACATTGCAGGTTGTTCTTTCTGCCTCCGTCTGCATTATGGTCGCATTGGTAGGCATTCTTTTGTGCTGCC GTGGAAGGCGGCAGGATCACCCGTCGACGACAATGAGTTGCTACAAACCTCTTCTTTTCTATCGGAGTTCATCACATGTG GCTAGAAAGTGTGGGGACCGGGGGCCGTCATTCATGCCGCTCTCACCATCGGATAAATGTCGAATTTCTGAATGGCTACT GGAGGTCAGAGGGCCATTGACAATAGTGGCAATTCGGCTTGCTGTGCCGGGATTGTCTGATCCACGGAACCCAACGGTAG TGGACTCTTTGGCGATGATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1830238: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18302383404514AI075563TENU3140T. cruzi epimastigote normalized cDNA Library


Date: 6:5:16 on Sun 19 Nov 117.