EST 1830241 is a singleton


Sequence

>1830241 (1 EST) Length=399 AGTGGCATGGCAGAACTACGAGCACTGCTACAGCGAGGCGTACGAAATGATGGAGCGTACGGTACGGATCGGCACTGCGG TGGTGGGAGAAGGCGAGAGCGTGGAGCAGGGCTCATTGGCGGAGGAGTCGCCGCTGTGCAGGTCGTCACAGGCAGCGCGG CTTGAGAAAGAGTGCGTCATGCGTATGTCACGGGGCGACACTGCGCCGTTTGCACGGCGACCACGCTCAGCGAATGGCGA GAATGACGGCGTGCCGCACAGCGATGTTGCTTCCACCGTCACCGGCAAGGAAACTGTCAGTCAGAAGACGGCCAGCGCGA TGAGCTCCTTCCGTTTTGGTCCGTTGGTGACCGCACCCGAGAGCGACGCAGTGAGCTTGGAGGTGGCTGCTGGGTGCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1830241: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18302413404517AI075566TENU3143T. cruzi epimastigote normalized cDNA Library


Date: 6:0:41 on Sun 19 Nov 117.