EST 1830245 is a singleton


Sequence

>1830245 (1 EST) Length=242 TGCACCGGAGATTGTCTTCGCTCGGCTTCGATGGGTGGGATGCGGTGACGGAGGAGGACGTGTACTCAGGCGCTCCGCAC TGCTACGCGGAGTTGATGCGTGCCATTCTTTTCTCGTTCCCCCACGATACGGCGGCGTTGATGCGCAAGTACCCGTGGCT CTGCATCGAGGGAGAAGACGGGGCCCTCGCGCATTCTGTTTTTGCGTCTGTTGTCTCTCGAGGGCAGCCGCAGATCGTCA TC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1830245: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18302453404521AI075570TENU3147T. cruzi epimastigote normalized cDNA Library


Date: 22:37:16 on Thu 23 Nov 117.