EST 1830247 is a singleton


Sequence

>1830247 (1 EST) Length=405 CTCCGTCTTCAGGCGGACGTAATAGACTTGCCATGGAACTGGCCATGTGAATTAAATAACCTTGAAGCACATGCCTTTTG CAGGTTTAAAAGTGAAGAATGGGGAAAGAATATCCGCATGCTGACGGAGGCAGAGTGGTTGCTTCTGTGGGATAGGTATG TTGGGAAGGATCAGATGGACTGGGATGAGGCACCTGGCAATCTCAATCTGGAACATTTTCAAAGCAGCTGCCCTGTGAAC AAGTTCAAACAGGGTCCCTTTTATGACATTGTTGGCAATGCTTGGCAACACTGTGAGACGAAAGTTTACCCTTATCCAGG TTACAAGGTTCATCCGTTTTACGACGATTTTTCGATGCCTACTTTTGATGGTCGTCATGCGTGCATGAAAGGTGGAGCGT GGGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1830247: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18302473404523AI075572TENU3149T. cruzi epimastigote normalized cDNA Library


Date: 12:40:17 on Sun 19 Nov 117.