EST 1830263 is a singleton


Sequence

>1830263 (1 EST) Length=553 ATTCCAAAGGTGATGCAGCTGGTGTCGGACTTTTTCGGTGGCAAGGAACTGAACAAGAGCATCAACCCTGATGAGGCTGT GGCGTACGGTGCCGCCGTGCAGGCCTTCATCCTGACGGGCGGCAAGAGCAAGCAGACGGAGGGCCTGCTGCTGCTCGACG TGACCCCGCTGACGCTTGGCATCGAGACGGCGGGTGGCGTCATGACGTCGCTGATCAAGCGCAACACGACGATTCCGACC AAGAAAAGCCAGATCTTCTCGACGTACGCGGACAACCAGCCGGGCGTGCACATCCAGATTGAGGTGACCTTTGACCTCGA CGCCAACGGCATCCTGAACGTGTCCGCGGAGGAGAAGGGCACCGGTAAGCGCAACCAGATTGTCATCACGAACGACAAGG GCCGCCTGAGCAAGGCGGACATTGAGCGCATGGTGTCCGAGGCTGCCAAGTACGAGGCGCAGGACAAGGAACAGCGCGAG CNATTGACGCAAAGAACGGTCTTGAGAACTACGCATTTTCGATGAAGAACACCGTAAACGAGCCGAACGTCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1830263: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18302633404539AI075588TENU3010T. cruzi epimastigote normalized cDNA Library


Date: 19:40:6 on Fri 17 Nov 117.