EST 1830269 is a singleton


Sequence

>1830269 (1 EST) Length=385 ACGGGAATGTGGTGTTTTTGCTGGCGGTAAACGAGGCGAACGCGTGTGCGCTGCCGCCCGGTATCGTCGTGCTGCTGGGC GTGGCGGCTGAGGACGCGTCTTCGCACAGGCCGTAGAGCACGCCGTTGCTTGCCACGGGCGGGTTGCTGCCGAAGGCCAC AACTAAACAAAACAAAAAACAAAGTCCCTGCCGTTGCCACTTCTTTCCAACCCGCGCAGGCGTGAGTTAAAAGAGGCGGC CACGACGAAAAAAAAAAAAAAAAAAAAAAAAAACGAAAAAAACTGAAAAATAAACCAAAAGCGAGCGACGGGGAAAACAA AACAAAACAAAACAAAAAAGAAAAAAGAAAAGAAAAGAAAATGCGTGGAAAGTGAAGTAACGGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1830269: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18302693404545AI075594TENU3016T. cruzi epimastigote normalized cDNA Library


Date: 23:54:15 on Sat 18 Nov 117.