EST 1830273 is a singleton


Sequence

>1830273 (1 EST) Length=580 GCGCTGACACACAAGCTCTGCGACATCACACCAGTGACGGGTGATGATGCCTGCTTCCTCCTCATCGACTCAATGATCAA GCACGACCTGCTTGGGGCAACGTCTGGAACGTACAACACAGTGCGGACGACCAGGAACAGGCGCAGGAGAAGATCTCGAA GCAAATCCTGGGTGGAAAGCCGTTCACCTTTACCGAACTTGTGCGTGATCCACACAAGTACACCACTACTGGCGACGCTG TCCACTTCATTAAGTCCTGTCAGAAGCAACTCACCCGTGGCGAGTTTGAGCGCGGATACTACAACGTCACCGAGCAGATC CGCACGCGTGACTTCATCGCTCTCACAGATGCGAGCACCGGCCTGACACACGAGGAGCGGTTCAGGGAGGCAGGTCGTAT CCTCAACGAGGCACACGAGGGTATGAGGACGCTCATGAAAATTACGACGGCAGAGCTGGACTTTATTCACGAGACCATCA ACCAAGAACCCGGAGTTGCGGGTGGACGCATGATGGGTGGCGGATTTGGTGGCTGCATTATCCTGCTGCTCAAGAAAAAC GTCGTGGACAGTGTCGTGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1830273: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18302733404549AI075598TENU3020T. cruzi epimastigote normalized cDNA Library


Date: 20:44:49 on Tue 21 Nov 117.