EST 1830275 is a singleton


Sequence

>1830275 (1 EST) Length=541 TCAGCGGAGGGGTTGGAGCGTCTGCAGCTTGTGCGAGGCCACGCGCCTCTTCCATTTCAAGGTGACGCTGTGATTTCCAC AAGCTTTGGTTTTGGTGGCGTCAACACGGCACTACTCTTCACGCGAGTCGAGAAGGCATTAATCTGAGAAAGAGGCGGGG GAGTTGCGTGCATTCGGTTTGTCGTGTGTTATTTTTTTCACCTTAAATAAAGCAACCTTTTCTCCATTTGGTTCACTCAC TTGCATGTGAAACTTCCCCGATATATATATATATATATGTCTGCTGGTTGTTTTTTCCCTCTTTCCTGCCGCACACAGCA ATGAACGATAGAGGCGGAAAGGAAGGAATTGACGAGTTACATGCGGAGTTCAGGGGGATGCATTTATGATGATTTCCCAC TTTATTTTTGCCGCACACAACCCCACGTTTATCGCATGAGGGGATTTATTTATTTGTGTGTGTGAATTGGATTGAGGTGG GAGTCAACACCGTGTAAATTTTTGGGAGGGGACACGCACGTCCCCATGCAAGCGTGCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1830275: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18302753404551AI075600TENU3022T. cruzi epimastigote normalized cDNA Library


Date: 11:47:21 on Fri 24 Nov 117.