EST 1830280 is a singleton


Sequence

>1830280 (1 EST) Length=441 TACAGCACATCGCCAATAGAAAAAAAGTCACAGAATAGAAAAAAAAACAAAAATAAAAAGATACAAATTTAAGAGATACC CTCGTGAAAATAACAATAATAATAATAATAATAATAATAACGGTAAAAAAAAGCATGCAAAAATCCCCATAAAAAGGGAT GAGATGCTTCTAATAATGATAGATGCCTTAACTCCTGCCTTGTTTTTTTTTTTTTTCCTTTGGATGCTTCCATGTGGCGC TGTTGAGTAATTCTTTTTTTTGCCTGCCCTTCATTTTTGGAAGGATTTCAGTAAGAAAAACGTAACCCATGAGAAAAAAT GTAAATGGACGATAAAAAAAAAAAAAAAGGAGGAGTAAAGCTGCTATATGTTTCTTTAAATTTTGCCACGTCGAGCTTGA GACTTTGTGTCTTGACTATTTCTGCCGTCGACCGCAAGATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1830280: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18302803404556AI075605TENU3027T. cruzi epimastigote normalized cDNA Library


Date: 20:0:24 on Sat 18 Nov 117.