EST 1830295 is a singleton


Sequence

>1830295 (1 EST) Length=523 CGTGCCATTTGAGGCGTTGATTGAAATTTTTTGTCGAGGCGGCCAGTGGAATACCGCCAGCCGCTACATCTCACTCGCCG GAACTCCGCCCACCTGCACGCTGCACACATCCCAACCCGCCCGAAGTAGGGAGGTTGCCGATGATGCTTTCAAGAAGGAC GACGCATCACATTTTTTTTCCCGTCATGTGGTGGTGGACTGTTTTCTTCTTAAGCGCCTCCTCGATGCCATGGAGGCTGC ACGTCAGCGTCATTACAGGCATGGGGAGCAGAGCCCTAGCGAGGGTGTACAGCATGGCTGTGGGCATCCCGGTTTTTGGC GGCTAACGCTACATATTCTTCAGCAGCAGCAGCAGCAGATGCTCCTTCTTCTCCCCAGTGAGGTGACGTCAGACGGTAAT GAAAAGAGCGATGTGGCGATTTCGTCTGTGACGCTGTTGGCTATCATGCAGGAGATTTCTAAAGGAAGAGGCGGCTAGGC GTCTCTCTTTCTCTTTCTCTCTCTCTCTGTCTCCCTATTGTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1830295: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18302953404571AI075620TENU3042T. cruzi epimastigote normalized cDNA Library


Date: 5:50:19 on Sun 19 Nov 117.