EST 1830299 is a singleton


Sequence

>1830299 (1 EST) Length=543 AAAAGGGGATCTTGTTGGTTTCCCACCCTTCTTTCCTTCCCTCCTTTCTCTATCTTTCTCTCTCTGTGGCACCGGTGTTA GTCGCGGAGAACACCGGAGAAGAAAAAAACCTCCTAACGGCACGAAGCACGGAGATGCTCAGTGGAAGATTTGTGGATGA CATGCTGAGGGACGGTCATGCATGGAGGCGAGCATTGAAACAGTGCGACACGCAGGAGTGCCTTGCGCCGTCGTCAAGGG CGGCAAAATCAAACATGGGACCCGTTTTTCGCCGCGGCTGCACCGACAACGTATGCAGCCTACGGTTTGTAAGCACCCTG CGAGCTCCCGCGGATACTCTCAATAGTCAGGAGAAGGAGCGAACGCTGCGGCAAAGAATGCGGGGGAGGTGGAACCCCAG CACAAAGCCAATCAACAGTCAACGTGACATACTTTTAGAACTTCTTCAACGCCAACTGGAGCTTCACGGATTTGCCACAG AATATAAGGAATCCCGTGACACATTACTGAAAGAGCAGAGAGGGGTGGAGTCGTTTTATCGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1830299: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18302993404575AI075516TENU3046T. cruzi epimastigote normalized cDNA Library


Date: 4:41:58 on Wed 22 Nov 117.