EST 1830308 is a singleton


Sequence

>1830308 (1 EST) Length=575 GTCGCATGTGCTACACCAGCACCGTGGCACCTGTTGCTCAAGCCGGAGACGCGAATGCAAGTGGTGCCGCCGGTAATCCA AAGCCCCCCTCATCTCCATCGGCCTGTGACGTCTCGGTATTTATTTTGTGCTTTGCGTGGGATGACCCACACAGCCTGAC AAACGTGCAGATGCGTTGGTACCGCGAGATTCGTCGAGTGGAGCAGGATTTGGCATTTCTAAGAAATGGCAGCCATTACA GGCCTTTTAATGTGCTGCTTTGTGGCACCAAGTTTGACTTGAGGGTCGATGCGGACCAACGGGGCATCACGGAGGGAATG GTGACACGGGAGCAGGCATACACTGTGCAGAAGAGCATCAAGGCAGACGCGTTGGTAACATGCAGCTCCAAGACAGGCTT TGGTGTGCGAGACGTGTTCCACACAGCCATGTTGTTGTGGCTCCAGAGACAGCCACAGTACGCGAGAGAGTTGACACCTA ATTTTCTGGAAGCTTTACCGATTGATGGTGATTGCGACAATGATAATGGCGTTGTCGACACGTCCAATAAGCAATCCATC GAAAGACAGAGCTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1830308: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18303083404584AI075525TENU3055T. cruzi epimastigote normalized cDNA Library


Date: 22:59:45 on Fri 24 Nov 117.