EST 1830312 is a singleton


Sequence

>1830312 (1 EST) Length=559 ACAGGGTGAGTGAGCAGGAGGAGGACGAGGAGGATGTTGTTGTTGTGGATGATAACGGGGAGATTCAGGCCACTGTGGCT GTTGAAAGCACCAATAACCAAAAGAAGGAATGTGATTGGATGTTTGACACGTATGAACTCACAGATGGCACGAACTGGCG GCAAGAAGAGGGTGATGAGGACAAATTGTTCTCCCAGCGTTCGAAGGTTGCGGCGTCTCACACCACACGGGGATCGGGGC GTGGACGTGGTGGACTCAAAGTACGCTCTGCCCCATGGTGCCGTATTTGTAATTGCTGCTATCTCATCTGCCTGCGCGCC CGTATCGAGAGGAATTACAGCGATGTCCTTAGCGATGGTCGCCGCCGCTTTCATGTGCTAAGGGATGATGAACAGGCGTT TACAAATTTAAATATGGCGTGGGAGGCACGAGTCGCACAACTAGACGTGTTGAAGCATCTTATTGTGGAACGCGCCACAA GCGCTGCGCAAGGGCAGATGGGTCACTTTGCCGGTCTCTTCAAGGAATGGATGCGCACTTGGGGCGGCGCACAGAGCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1830312: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18303123404588AI075467TENU3059T. cruzi epimastigote normalized cDNA Library


Date: 6:57:8 on Tue 21 Nov 117.