EST 1830315 is a singleton


Sequence

>1830315 (1 EST) Length=535 GTTGTTGTTGTTGTTTTCCCCCCCTCACAACCACACATTTTCTGTGATTTTTTTTGTTTGTTTGTCTGTTTGTTGTTTTG TTTTGTTTTGTTTCTTTCTTGTGTGTGAGTGTGCGTGACCTTCTCGGGTGTGGCTCTTGTTATGCACACCCATAATCAAA CTGACTTTGCACACATACAATGGTGTACCGCATTTTTTTTCTTTTCTTTTCCTTTTCGATTTGGCTTGGAGTGCGTCGGC CCCATCACTCGCACTCGCTACGTACATATGGATACATTCAGACTGGGTATATTAATATGTATGGATGTATACATTGAAAT ATTCACTGAAGGATAAGGAATTGGAGGGACGTCATGAAAAGGAAGAAAAGAAAGAAAAGAAAAACAAACAAGAGAATGAA CACTGATAATAATATCAACATTAATAAATAAATAAATAAATAAATAATGCGGTTGGGTATGGATTGGAGTTTCTGTCTGT ATTGAGGTGAAGGTGATCTGTTCTTATGTTTTATGCCTTAGAGAGAGAGAGTGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1830315: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18303153404591AI075470TENU3062T. cruzi epimastigote normalized cDNA Library


Date: 2:41:5 on Fri 24 Nov 117.