EST 1830316 is a singleton


Sequence

>1830316 (1 EST) Length=291 CTTGAAGCTGAGGTCTGGAAAAGGTATTCCTTGAGCGTATTCTTGCGTGTGGAGTTTGTCACTTCCATGGCGAAGGATCT CAATGAGCTGCCGCCACCATCGCCTTCCAAACCACGGCCCTCGGTGCTAACGTTAAACCCTCATGGTCACCCCACCGAGG CAACTGCAATAAGTAAACTGAAGTCAGTTGGTCACCAGCAAGAATTAAAGTATCGGGTGCTGTACATACCGACGTTCCAA ACCTTTCCGCTGGTGGACGGCTTTTCTTCATGGAGTCACCGCGGAGACGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1830316: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18303163404592AI075471TENU3063T. cruzi epimastigote normalized cDNA Library


Date: 23:46:15 on Fri 17 Nov 117.