EST 1830319 is a singleton


Sequence

>1830319 (1 EST) Length=320 TTATCCCGAAATGTTCTGTCACCGCGACACCAGCGACACAACGCGTTACTGCACATCCGACCGCGTTCACTTGGGCATCT GCAGTTCCTTTGCCGATGATCAATGCTTGTTTATCCAGCCGATGGGTTTTGGCTCCTGCCGCGATACGACCTCAGTCTTG CACGGAAGCCGCATGGGAACAAGCTCATGGTGCCTTGACGGAGAGTCTCTCAAAGTGAATGAGGAAGTGCTTGAAACTAA ACCACAAGTGGTTTCTGTTGGCGGTGTGTGCGTGGAGGTGTTTTGCGGCAGGAAAGAAGTCAGTGTACGTTACCTTGGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1830319: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18303193404595AI075474TENU3066T. cruzi epimastigote normalized cDNA Library


Date: 20:48:46 on Wed 22 Nov 117.