EST 1830320 is a singleton


Sequence

>1830320 (1 EST) Length=568 TCAGCTGCACTATGTTTTTATTGGACTTCACATGGCAGTTGTTATTGCCATTGAGGCGATTATTGCTCCTGTTTTAATAA AAAGATGTGGTGAGATGAATCAGTGGATGATTCATACTTGTGCCGCATTTCTTCTTTTTGGCTCATGGCTCAGTCCATGG GTAAGTGAAAACGGCCTTTTATTGTACCTGGGCGCAACAATGCTGTTTACGGATCTTCCCGCCGCCATGTTAGGAGTGGT GTTTTCTTCTGTGGCTGAGAATGGTTTCAAAACGTCTGACAGGGTTTTTTCAAGCAACCTACATCGCCATGTAAAGCAGT TTTGCAAGCAATGGTCTCCTATCCTTCTTATATTCGTTCACAGTATGTTAATTGACCGTCAAGACGCAACTCGTGTCGTG TTGATGCCTTTTTCAGTTGGCTTGGTGACAATTATTTTGACACATCAAATCAAAAGAGCATTGGCCGCTATCTTTGTTTC TGGTTGGGCCATTGCGACCTTCTCTTCTTTGGGCGACGAAGGCATTTGGGTGACGTTGATTTCAACTATTGGCTTAATGA TGGTTGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1830320: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18303203404596AI075475TENU3067T. cruzi epimastigote normalized cDNA Library


Date: 10:49:48 on Tue 21 Nov 117.