EST 1830322 is a singleton


Sequence

>1830322 (1 EST) Length=515 TTGGCGGTGACGTTAACGGACTCCACTCGTACATCGGCGCCACAGACTATCGTGGTGATTGGTCGGCCAGAGGACGTAGT ATACCGTGGCCTTATGAGACTATAGAAAAGATAGGACTTCGCACAGTATACATATATATATATTAGAGAGAAAGAAATGG AGAAAAAGGCCAGACGCACACACGTACACCTTCTCCGTCGGCCTCAATTACGTCCCTTTTTTGTTTGCCTCGCTGCCGGT ACCGTCATGATGAGATAATCGGAAGTGGACGATCTTCAATGCACCATTGTAGTTGCTTCCAAACGCTCTCCACACATTGT CTTATTTTTTTTTTTTGTTGTTTTGTTTTGTTTTAGTTCTCATTCCCAATCACACGGATAATTTCTAATATATGTATGTA TGTACCGTTTTGGTTTGTTTGATTCCTCTCGTTCTCTCTCTTCTTTATGTGTTTGGCTCAACATGATGGGGGGTGGGCCG CTGAGAGAAAAAGGACGATGGGACGACAGACATGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1830322: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18303223404598AI075477TENU3069T. cruzi epimastigote normalized cDNA Library


Date: 2:30:21 on Thu 23 Nov 117.