EST 1830336 is a singleton


Sequence

>1830336 (1 EST) Length=348 TCACTAAGCGCCGACGTTGTGAAGCATCTTGAACCAAACGAAGTGAAGGTGGCAGTCGCCATTCACCATTTTACTAGTAT TAATGATGATAGTTCAGTGAGGCTGTTGCAACAATTTGTGGAATGGGAGGAAGGTGGCTTTTCTCTTCTCCGTAATAATG ATCGAGTGTATCTGGTACCGGTGCATCTCCAACAGCAGCCACGCCACTTCCCTGTTTGCCCCCGCCCGGCACCAAATTCG CCTGAAATAATTCCGCTGCATCGAAAACGCTGCCGTACCGTATCGCCCGCGAATAGTCGAAAAAGACCGGATACAGGAAC TACACCACCACCGGATCTTTGGAGTCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1830336: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18303363404612AI075491TENU3083T. cruzi epimastigote normalized cDNA Library


Date: 16:25:2 on Sun 19 Nov 117.