EST 1830348 is a singleton


Sequence

>1830348 (1 EST) Length=407 GACCAAAACCGCGCGTGACACTTTGCAAAGTGCCCGGAATACGCCTCATACCGTTGCACCCCTTAGGCGGCACCGTGTTC AACAGGATCACGCTGCAGAAGAAGAGGAAGAAGAAGAAATCATTGCACGCTTTTATGCAGACCAGCATGCACGCCGTCAA GAGCCACAGCCACACATGGGCACTGATCCCACTCCATTGCCATCCGTACCGGATGTAAGATACACGCAGCCAAATCGTCA AAATGACGATAATCCACACGTAGGAAATCAGCTAGCCATGGCATCATCGTCCACAATTCCTCAAAACATACATGACTCCC ATGTGAAAAAAGAGCACGCGCGCCCTATGGAGGATGAACCAGAAAGAACAAATTGGGAACACGAAGGTGAGTCTACTGAA AAAAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1830348: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18303483404624AI075503TENU3097T. cruzi epimastigote normalized cDNA Library


Date: 23:47:15 on Sat 18 Nov 117.