EST 1830350 is a singleton


Sequence

>1830350 (1 EST) Length=480 CTTGAGATTTTTTATGGGATGTGGTGTATGCTTCATTCAACATCCAATGTACGACTTTCGTATTCGTGGCTGCTTCATGC AAAATGTTCCCACCACCTGTTTGGAGATCTCCGTGGGTGTTCCCGTCATTATTTGCCTTATGCTCTCCCAAGATGACATG CGTGGTACCGATAAGCAGGAGTATTCTCCGATCATGATCAGCGTTGCACACGGTTTTGGTTCCATGACACCGATGAGTGT CGACCTCAACAGCGGTTTTGACACCGACCACCCTTCGCCTGAGTATGCATTCTTCCAGACCCGTGAGACCAGTATGTTCT ACGAATTCCTGCCCGAAAATTCACCTTATTTGGTGGTACCACGTGCCATGAGCATGTATCCGAAACTACCATACGTTTTT GGCTTGCGTAGTCCGGTGGAGGTGGGTACACCAAATAGCCAGGTGCGAGTTGCGTTTCGTGCCCTGTCACCCGGATGTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1830350: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18303503404626AI075505TENU3099T. cruzi epimastigote normalized cDNA Library


Date: 13:23:33 on Wed 22 Nov 117.