EST 1830352 is a singleton


Sequence

>1830352 (1 EST) Length=374 AGCGAAACTTCGATGCGGACTTTGTGTGGGTGCGTGGGTGGGGGAAAGTGCAGTGGAGGGTGTTGCATGTATTTCATTCC ATCTGTGTGCGTAGATGTATCCTTTAAATGCACTGTTAAGTAATTCCAACCTTCACCCACACCCACTTTCTTTTTTTGGT TTTCTCCGACTATTTTTTACTTTTTTATTTTTTATTTTTATTTGCCTCTTTGTTTTTATCGCCGCCGCCGCCACCGTTGG CTCTCTTTTTTTTTTTTTGGTTCTGCTCCGCCCAATTGTGATGGACTTCTTTCCCCCATATGGGTTGCCGTGTGCTGACA CCGTGGCGGTCTTTTACCATTCCGTTGAATGAAGTGTTTTGTAGCCAAGCAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1830352: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18303523404628AI075507TENU3101T. cruzi epimastigote normalized cDNA Library


Date: 13:14:7 on Thu 23 Nov 117.