EST 1830355 is a singleton


Sequence

>1830355 (1 EST) Length=165 GTGTGTACATCAGTCTATTCGCACGCAGCGGACGCACCATTGAGGTTTCGCCAGCACTGCGCCCGCCACGCACATTTCGC CGCTTCAAAGGACTTGTCGCCGCGCTGCTCCGCGATGGTGCGGTGCGGTCGGTGGATGGGACTGTGCTGATGAGGATCCT GCCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1830355: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18303553404631AI075510TENU3104T. cruzi epimastigote normalized cDNA Library


Date: 6:3:30 on Wed 22 Nov 117.