EST 1831792 is a singleton


Sequence

>1831792 (1 EST) Length=391 TGTCTTCATCGAAAAATAAAATAAAATTAAATCCACTGGGACGGTGAGCCAATCAAGGGCGGATTGCTATCTCATTCTTC CTAATGAAGCAATCCCTTGTCTCGATGACAGAAAATAATAATATTAATAATAATAACGAAAAAAAAAAAAAAAAAGAAAT ACTTTTGGATGTCGCCTGCATTACTCTTCACGCAAAAGAGAAAAGCAGCAATGGGAAATGCCGGTTTGCTTCACCGCGCC CAACACCCTCCATAGCTCGGAGAATATTCATCTACCACTCACACGCCAGTAAAGACATTCACTCCAATGGCGTTCTATAA TAACTGGGCTCATTGTGAAGTCATGGCGCGGCATTCTTTGGCGTCCCACAACCGCCCGGCTCCTCCGTGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1831792: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18317923411326AI077249TENU3163T. cruzi epimastigote normalized cDNA Library


Date: 23:21:40 on Mon 20 Nov 117.