EST 1831795 is a singleton


Sequence

>1831795 (1 EST) Length=304 GGTCAAGGAATAGGACTTTCTGCATCTTGGCTGCTGACCGCAACATGCGCGGGGGTCATTGCATCCGGGCGATCTAGTGG ATGCGGTTGAACACTATCGTCTTCACAGAAATAGTATGCTGCAGGGGTGCATGCGCATCTGCACCCTTTCCAAGAGGTTA TGACGAGGGGAATGAGGTGGGATATGGGAAATACTGCGTCACCGCTCGTTTTGTACCGAACCCAGCGACTCTTTACTGTA AATTTTATTCAAGGGCGTTTGGTGGCTGCCTCGAATGCCTGTGGTCATTATGTGAGGATTCCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1831795: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18317953411329AI077252TENU3166T. cruzi epimastigote normalized cDNA Library


Date: 3:55:49 on Thu 23 Nov 117.