EST 1831797 is a singleton


Sequence

>1831797 (1 EST) Length=429 GGTAATTTATTTAATTCGTTTAGCAGCGACGCCCATTTCTCGAGGGGCCTTCATTCTTGTGCCACTCCGTCAATGAGAGC CTTTTTTTCTTCTTCTTCTTCTTCATGTCTTTTCTTTTCTTCTCCATCCGTCCATTTTTTCTTTTCTTTTCTTCCCTCCC TTTTATCCGCTCCTCAAGTTCACAGTTTAACAGCAATCATTAAATGTAAATATGCGTTTTTTGTTGTTGTTTTTTTTGTT TGGGAAAGAGGGGTGGGTGGGTAAAGAGGGCGTCTGCCGCGACTTCCGAGCGCCATCCACAGGCGCTTGCGGCTCCCTAC GCAACAGACACACGCTCCGTCTGCCACCCCTCTTTCCCCCCCCTTCCGCCCCGTTTCTCGCTGTCCTCCCATCGGGTGGG GAGGAAAAAAACAAAAGACAACAACAATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1831797: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18317973411331AI077254TENU3168T. cruzi epimastigote normalized cDNA Library


Date: 9:47:52 on Thu 23 Nov 117.