EST 1831810 is a singleton


Sequence

>1831810 (1 EST) Length=486 GTCGTGCAAAAGTTACTTGAAGAGACAGGGAGTCTTTCTTCCGATTTGGAGAAATTACGGAGTGAAAGGGCGTCGCTGGT GGAGAAGATTAGCATCACACAACAGGAGTTCCAGTCCTTTCAAACCAAATGCGAACTCATCGGATCCGTTACGGAATCGC AACTTGCGTCACTTTATGAGGAAATCAACTACGTCAAGCGGAGTTATCTTCAACAGTGGAATTGCAATAAATTGAGAAGG TCCGACGTGCGAGCGATGCATCTAAGAGTAGAGGAGGTTGTAAATACAACTGAGAGACTGCGGCAACAAATAACAGAGTG TTCAGAAAGGACGATAAGACTACTGCAGAAACAGTACCTCATGCACCACAATGAAATTACTGAAATAGAAGAAAAAAGCC TGTTGTTCCGGCGTTGGCAGGCCCTACGTGGGCGTGACGAGGGGAGGAGCCACCTAATGGTGGAGGTTCGTCCTGTTGCG CGGGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1831810: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18318103411344AI077267TENU3181T. cruzi epimastigote normalized cDNA Library


Date: 18:22:29 on Fri 17 Nov 117.