EST 1831812 is a singleton


Sequence

>1831812 (1 EST) Length=577 ATGGGCCACGGTGCCGAATGCCATGATGGGTTTGTTCCACCAACATCTAGACGTTCTTCGCTCCGTTCACCACGAATCCA CCGCAGCGTTAGAAGAGGCGGTACAGCTGCTACTGCAGGAACGCAAGTGGATTACTATGCGATGCACGATTCTCTATGAT CGCCTGCAGCAACTTAACCGTCACCGCAACAAAATGATTAAACGGTTACGGACTGTCCATGGGGACTCGACGACGGCATT TTTTGCAAATATGAGCGTGGAAGTTTAGGCAAATGTCGAAAAGTGCCACATAAGGTCAATGTTCCTGCTTTAAAATACTT TTCCTCCCCACAACGGTGCTTATTGACATTGACAGAACGCATCTCTTTTCTTGTCTTTTGTCGCCTCTGTGCCTCACAAC AGTTTTTGCATCTCCTGGGAGTTTCGGATGCTTCTTTTTTTGTGACAGGATAGGGTGCGGAAGAAGGGTGGGTTGACGAG GGGCAATTTTTTTTTTTCATTTGGGCTAGAACACACTAACTCCAACTCTGCTGTCCACCATTTATATACATATATATCTA ATTTTGTATATGACACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1831812: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18318123411346AI077269TENU3183T. cruzi epimastigote normalized cDNA Library


Date: 6:12:43 on Fri 24 Nov 117.