EST 1831814 is a singleton


Sequence

>1831814 (1 EST) Length=565 GGAGTTAGAATTTAAGTGCAATGCCAGCACTGTGCACGGAAATAAAACCGAGCCGACCGCGCGCATTGTATGAGCTTTTG ACAGGTACCACTGTGAGTGATGGAGGCTTTTTTGTGACGGACGACCGGCTCTTAGGCTGCTCGCCAGACGGACGCATTTT CTACGATGTGAATTTGTCGCTCCCCAGTTCATCTGACTGTGTGAAAAGCGACATCGAACACACTTCTCCAGACACTCCGG TGAGTGTGCCGATACCATTTTGCTCAAAATGGGGTCGACAGGGGAAGCGGACAGTGGCACCAGCACGTGTCGCCACTCAG CGGGCGTGCCGTTTACTAGAGATAAAATCACCATATTACTCCCTATACGATGGGTCAAAGCCGGAATATCAACCGTTTGG TATTCCGCTGCATTATCTTTGTCAAATGCAGGGGCAAATGGCAATTGCCAACGCTGATGAATGTGACTTCTTTGTGTACC TTGATCGATGTGTCTGCCAGGTGGTGGCTTGGCGTGTGAGGCGACGAGCGAGTTCTGGAAATGGGCGAAACCCAAGCTGC TGCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1831814: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18318143411348AI077271TENU3185T. cruzi epimastigote normalized cDNA Library


Date: 3:59:30 on Sat 18 Nov 117.