EST 1831821 is a singleton


Sequence

>1831821 (1 EST) Length=360 CTACGATGAGTCGATCTGCAAGAACACGCGCGTTGCTTACCCGCTGAGCCACATCGAGGGCGCGCTGAGCAAGGCCATTG CTGGCCATCCGAAGAACGTCATTTTCCTGACGAACGACGCCTTTGGCTGATGCCGCCCGTGGCTCGACTGACGAGCGCGC AGGCGATGTTCTGGTTCGTGATGGGCTACACCGCGAACGTCCCAGGCGTTGAGGCTGGCGGCACGCGCACTGCTCGCCCG ATCTTCTCGTCGTGCTTTGGTGGGCCATTCCTCGTGCGCCACGCGACGTTCTACGGCGAGCAGCTGGCGGAGAAGATGCA GAAGCACAACAGCCGCGTGTGGCTGCTGAACACTGGTTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1831821: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18318213411355AI077278TENU3192T. cruzi epimastigote normalized cDNA Library


Date: 14:10:50 on Mon 20 Nov 117.