EST 1831828 is a singleton


Sequence

>1831828 (1 EST) Length=574 TCTCTTTTCATGCCGGATCACCCTGTTCCGCTTCATCAGTTGATTAATCGTCTACCACCAATTTTGAAGGCGGCACTTTC TTTGCGACACAAAAACAACTTTAAGACCAGTAAGCATCTAAAGGTGTGGAATGAGGGCAACCGCACGATGCTGCAAAAGA GTCAATTGGCCGTGCCGGAGTCGGCTTTGATGGGCGAGGAAACTATTTCTGTAGAGGATGCTATTGAATCGGTACGTGAG GTGATACCAGATGAAGGTGTGATGATAGGACATCTGCACCGTATGCTTCCCTATGCAGCTAAAAAGACGTTAAATACACA CTTTGGAAATGTCTACAACGCCATCCTTGGGTATCCACAGTACTTTTATATTGAGAAGGTGGAGGAAAACAGATCAAACA GCACGGTTTTTCTTGTTGAGCGTCTTCAAGAAGAGATACAATGTTGAGAGCCAAGTAAGAAACCTTTTTTTTTGTTTTGG GTGTATTTGTTTTTCTTACTGAGGCGCGTTTATGCTTGCGAGAATGTCCTGTTGGAAAATGGAAGAGAAAAGGATGTTCA CCTTGCGTGCTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1831828: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18318283411362AI077054TENU3199T. cruzi epimastigote normalized cDNA Library


Date: 9:36:26 on Fri 24 Nov 117.