EST 1831830 is a singleton


Sequence

>1831830 (1 EST) Length=598 GCTCATCGAGACGCGGCAAACGAAGCCGTGTTACCCGACGGCGACACGAGAGGGCACCCCAAGCCCCGCCCCTGCGGTTA CTGCACCCACAGCGGGGAATCCACCCGACGCCCCTCCATCTCTACCACCGAAGAAAACAATGGAATTGTCTCCGCTCGTA GCTTCTTCATCCGGTATAAAAATTCCATCTACCACTCCACCGCTCGCAGTGGCACCCGTCGTCGCACCATTCAAACAGCT GGAGTCTCTCCATTCCGCACTTCAGCTCAATTTTGTTCCACGCAGCAACGCCGGCACGAACAACCACAACCACAAAAGCC CCAAAGTCACTGGAGACACAACCAAAAATGTCAACGACATTGATAACCACCACCCGGTTCGGGCTGATATTCCCGATAGG AGTATGCCAACGGGAGGTGGCGTATCTGTTATTGCTAGGCAGTCGATTGAAGAAGAGTTCCACTTTGAAGACCTAAAGGA ACTGCAGCGGAGGCGACGGCAAGAGGAGGAAAATGAAGAAAAACGAACAAAGCGGAGAAGGAGTAGTAGTCACCGAAGAC GTCATCACTCTGGTGAAAGGCGCAAAGGTCGCTCGAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1831830: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18318303411364AI077056TENU3201T. cruzi epimastigote normalized cDNA Library


Date: 2:36:31 on Thu 23 Nov 117.