EST 1831840 is a singleton


Sequence

>1831840 (1 EST) Length=515 GGGCAAGTTTTACTTCAGCCCTTTCCCAGCGTTCTTCAAAAGAATAATTGCAACAAAAACAAAGAAGAATGGGCTCGTCT ACCTCGAAGCATAATCCCAAGGAGCTTCTCGCTACACCCGCCATGCGCGGTGCCATTGAGGAGTGGCTTTTTAACGGACT TCTTCTCAGAATCATTGATCGCAACACGGGCACCTGGGCGTTTTTCAACAACTCTAGAGACTACGAGTTTCATATTGCTT ACCTGTTACACCCGGACAGCGCGGTGCAAGCTCTAAGCAAGACAATCATTACGCCCCAGGACGATGGCGTGCTTTGCGAG ACGTCCGTGTACCCGCTAGAGACGCAGAGGTTCTTTGTTGGCGATGTCAGTGGCTTTGAGAGCAAAATTGAGGCACTTCC GCTCTCGGCTGAGTACCTTCAGTCCCACACAGATATTGATGAACGCAAATACTACCGCCGCCTCGTGCCCCCCAGTGCTG CCACCTTTTAGACGCGGGCCGAGTGACATGGACGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1831840: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18318403411374AI077066TENU3211T. cruzi epimastigote normalized cDNA Library


Date: 3:51:10 on Sat 18 Nov 117.