EST 1831846 is a singleton


Sequence

>1831846 (1 EST) Length=592 TCAAAGAGCCCGACAGATATGCACGCGGCATATTCAGCGGAAACAGGTGTCACCTTCAGTGGGTAAATTAGTAGCCAATT GCGGTGTCGGTCGCCCACGGTGAGAAGCAGCGTTGTGCTCACAATATTTTTGGCTTGTTTTCTGCTTCCCTCCCCTTCTA TTTCTCCCTCATTCACCATCTTCACTTTTACTGCTTGCTGCCGCCCTCTCTTACCTTCGGCAACACTGCCAGGTTTGGAC GCTGCACCCTCCCCCTGTCATGCCAAATATATGCTTGCGCTCTTTAAAACCCATGGCGTACTCGCTTAAATATCATTTGT GTAAATATAAAAATTAAAAAAAAAAACTTTTAATAATTAAAGTGAAAAAATAAAATAAAATAATAAAAACATAAAACTTG CAACTGGCGCCAGTTCATCTTCCTTTCGTCCTTACAGGGTACAAAACTGTCCTGTCGTACTCAACCTCTTGGAACCCCTT GCTTAGCCCTTCAAGTCCGTTCCCTTGACTGTCGTTTCGCTAGATAGTAACTCGGGACAGAGGGAATCTCATTAATCCAT TCATGCGCGTCTCTAATTGGAAGACGAGGCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1831846: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18318463411380AI077072TENU3219T. cruzi epimastigote normalized cDNA Library


Date: 19:29:42 on Sun 19 Nov 117.